Week 13 - Lisa

I was so excited to find hard salami in the grocery store this week.  I resisted testing it for two days.  Finally cut into it and by looks was down right giddy.  Only to taste it and realize, nope it's not even close to my beloved Gallo Dry Salami from home.  Wah!

Baseball season started!  It's tough being a fan when you are living half way across the country.  Luckily, with new technology we can see the games via cable and internet.  So we just move the furniture around and watched Saturday nights game against the Dodgers on the laptop.  Nothing gets between us and our boys, the Gigantes!

Um, is she saluting me?

That looks says about a million things, most of them not publishable!

Week 12 - Lisa

It was a stormy week for a lot of reasons but mainly the weather.  Yikes, what happen to the beautiful sunshine the week before?  March had no lamb this year.  In with the lion, out with the lion.  I was actually grateful for the rain cause the pollen was a killer this past week.  By the time Saturday rolled around my March Madness bracket had exploded so I was left to root on my mom and sister.  Oh Elizabeth, how we will miss you!  Growing up I wanted to be Natalie Wood.  Her death was such a shocker.  I loved Elizabeth Taylor but I knew even as a 10 year old girl she was more "broad" than I was ever capable of being.  ;>  Giant, Cat on a Hot Tin Roof and Who's Afraid of Virginia Woolf were my favorite movies of hers.  Woke Sunday morning to read about Geraldine Ferraro.  Growing up in the 60's and 70's I was right smack in the middle of the women's movement so when Geraldine ran for VP, I was so proud and excited.  She was truly a trailblazer.  A fiesty, smart lady.

Here's some pictures I took this week with an iPhone app I downloaded called Hipstamatic.  Kind of cool.

Week 12 - Sis

Going from a beautiful week of sunny weather to one that is the opposite is not working for me.. Most of us know life can be a carnival, rocky at times or even a puzzle and think my week has covered all three parts. March Madness can represent more than a basketball tournament, although this year's event truly was madness with some surprising upsets. My own upset came when Ohio State lost! The most exciting part of the week was Saturday night's storm which sounded like a direct hit over our apartment. The news of Elizabeth Taylor and Geraldine Ferraro's deaths was a loss of strong, stand out representatives in the arts, politics and human rights. Hoping the new week will lift us all up, brighten our days and give me a couple of payoffs from the pools I'm playing in.

 

Week 11 - Lisa

Sad week.  Our cousin, Carol, or as she is known in our family, Sis, passed away.  So not a lot to report as my attention was mainly focused on her, her family and our entire family.  Other than that we are consumed by March Madness.  I gleefully rode through all of Thursday in first place but my underdog picks late in the night sent me spiraling to the bottom of the pack.  By Sunday night I had a severe case of  "potty mouth." We experienced the Super Moon on Saturday.  As my mom wrote it was kind of disappointing.  I did try the different color modes on my camera for some interesting results.  The last picture below is my favorite.



Week 11- Sis

Our view of the Super Moon was a bit disappointing last night. Thought it would be much larger but have to say it was very bright. It appeared after a lovely day in the 80's and then dragged those clouds into an overcast Sunday. Back to sunshine and warmer temps this week.

March Madness is just that. Notes, stats all reviewed and written on multiple pieces of paper and then transferred to my brackets sheet. One thing, red circles on the paper are not good. Heading to the Sweet Sixteen with a 1st place position in one pool and 16th place in a very large pool. Nope, no extra points for being 16th going into the Sweet Sixteen but thank you anyway.

Just like this one orange tulip Sis, you stood out in your family. Memories will sustain us in our lives and from the sadness of losing you too soon.Rest in peace cousin you will be missed but you are in our hearts always.

Week 10 - Lisa

Mail!  Let's talk about it.  Everyday my mom makes the trek up to the mail station to see who sent us what.  Will we receive goodies or news from home?  Which magazines?  We get lots and lots of magazines.  Or what kind of weird advertising or offers have come our way each day?  Well this week started off with me receiving a few items from a location called looneystuff.com.  The below note and pack of Hubba Bubba bubble gum came with my purchase.  I haven't chewed Hubba Bubba since playing softball.  A flood of memories came back.  Good times!

Next day in the mail I received the annual "Oh Lisa please please please buy magazines to support the Girls Scouts, or my school, or my Little League, you are such a sucker and I appreciate it so much, I know you'll do it because you had to when you were young to help support your softball or basketball team, so please please please?"  Love one of your our guilt-trip applying cousins or godchildren, Anjelica or Jacob or Jerome or Christina or Alannah, or winner winner chicken dinner today was Veronica Rose.  The list of possible beggers could go on and on.  ;>  The other piece of mail was from American Express. I've been working a lot of hours and days and feeling SO antsy to go on a trip.  I need a four or five day getaway badly.  So what comes in the mail?  American Express Rewards Guide - Grrr!  Cruel and "usual" punishment. 



And the last interesting or mention-worthy was my Genographic Project results from National Georgraphic.  My mom and I were so excited.  Going to see where that swab of spit led too!  Where are we from officially? 

AAATTTCAATTGAATTATTTGCCCAAATTCAACCCTTTAC - there ya go.  

A string of 569 A, C, T, and G letters makes up my very vague Mitochrondrial HVR 1 Sequence.  Something about nucleotides, the chemical building blocks of life, followed by the words - a mutation splitting; usually harmless.  USUALLY HARMLESS?  What the ????  I read that and snorted.  Now things about my family are seriously starting to make sense!  But the bottom line is the report we so anxiously awaited said <drum roll>  your people came from Africa stupid, just like everybody else.  Ms. Mitochondrial Eve as they named her started it all.  <sigh>  Well, hello I learned all this in Sunday School when I was four.  Oops, I forgot this is "science," so now it's really real.   Oh wait, that was a different Eve, this Eve goes back about 170,000 years.  Uh huh, sure.  Just my opinion people, calm down. 

So that Friday, on a return trip from getting lunch I have to wait and wait and wait for train to go by so I could get back to work.  Hmmm? Maybe I should open the door, jump out of the truck and onto the open door car of this train to wherever I ponder.  No mail, no offers, no requests, no hubba bubba. Maybe I'll be the next Ms. Mitrochrondrial Eve in our family to split off causing some future family member to ponder what the heck happen in the US around the 2011 time period.   Then reality and my common sense genes took over... With no money, no food, no internet. Um, yeah right!  Go back to work Lisa.

Week 10 - Sis

Food. We talk alot about it here on the blog and eat a lot of here in the apartment. If you know us or saw us, it shows. So Monday starts with me wanting to cook a hardboiled egg for potato salad. Reached for this little guy and put it in the microwave and 10 minutes later I have a Jackson Pollack imitation. You should have heard the pop one egg blowing up in that little microwave can make. Starting with a regular egg but didn't know a devil egg was my downfall!

Cat food I dropped while filling sunii's bowl. I tried to explain to her it was a fun way to eat it. Her look was telling me,"talk to the paw." Yeah. well a DOG would have been all over this prissy girl.

Thought these sliced leeks looked so colorful when I was preparing a soup tonight. Oh yeah, dropped half the fried bacon bits that were a needed ingredient and one that I love, on the floor. Finished the week almost as bad as I started it. Think we should eat out all next week. Sigh.

Week 9 - Sis

Weather report was done by Lisa, so will move to the weekend as my week is pretty routine, like most. Friday we hit the road to go pick up our trial pottery pieces we created. Think now, Friday we hit the road and all the work traffic heading home, yes a great plan. We then took an off ramp prematurely and had to depend on the GPS to find our destination. Turned out to be a pretty part of town and we soon arrived. Well, we were okay with the first results of our efforts and already realized, besides being amateurish, what we would do different the next time. As I had no idea what to do with my piece for now it's a napkin holder. Saturday we ventured out during the rainest part of the day, we were on a roll with picking times to travel. Sunii had done a good job on her scratcher so replaced that. Since it came with a new packet of catnip she was satisfied and high. New socks! Such a simple purchase and brings me pleasure, no I'm not high. I think I'm turning into a shopaholic, I mean to spend an hour and a half at two stores is way beyond my normal limit. To top it off we had to go out on Sunday and grocery shop! I'm so happy tomorrow is Monday and I can rest.

Week 9 - Lisa

March is upon us that means tornado warnings.  The skies turned that dark gray & green early in the week.  It's so eerie to watch the clouds go buy at such fast speeds. Most ATL'ins yawn at the tornado warnings but having experienced them in Chicago and being right in the eye of the storm when the tornado ripped through downtown Atlanta in '08 I keep my "eye" on the news.  However overblown the hype the weathermen broadcast, I like to know whether to pack up, take cover or sit in the bathtub.  So I'd say March came in like a Lion this year.  Not to get all nerdy but in my first picture, I love how my camera picked up the new buds on the trees.  Quite the contrast again the brooding clouds.  We picked up our last weekend pottery projects.  We were both pleasantly surprised with the results. I already have a project cooking in my mind so we will test our artistic abilities once again in about two weeks.  Lastly, I hate purses, especially shoulder bags. Most ladies dream about Coach & Louis Vittion bags.  Me?  I prefer to carry the minimal amount of personal stuff with me at all times; the smaller the bag I have to carry the better.  I love the wallet/phone style whatchamacallits.  So when I discovered a sale while at Kohl's I "had" to pick up a few.  My taste you ask?  The more colorful and playful the better, my mom always looks at my choices and rolls her eyes.  WhatEVA! In closing this week, I will prepare you now March Madness will be upon us come next week.  If you don't care for sports, specifically basketball, you might want to come back sometime in April!  ;>