Week 14 - Sis

Indulge me. Found a sweet mutt at the Atlanta Pet Rescue on Saturday and adopted her. She is a Corgi mix. We named her "oneeya", pronounced - Oh-nay-ya- in our mutsun tribal language and means female friend. Yep, she's my new girl friend! I know MasterCard has that commercial about charging items, for different events, making the moment priceless and that's great for a once stray dog but it may make the card holder penniless! One day items purchased at PetSmart; a bath, phew she needed it, a collapsible water bowl to carry in the truck for her when we're out riding around, food bowl, water pitcher that releases the water as needed, a soft stuffed toy, a can of treats, and new id tag. Still have the registration micro chip charge to go. My daughter is willing to pay the apartment pet deposit. That is all important but the biggest worry was how well would she adjust to our environment. Think we can relax, might say she's a Giant in that field!

Message from Dos Dames #8 ~

We had a WILD storm last night.  Apartment building was shaking.  Materials were hitting the outside wall of my bedroom keeping me up all night.  Lightening was illuminating the room.  The winds were howling.  Electricity flicking off and on.  Once again, our ATL weather girl Megan McGlover nails the scene!!  LOL

Check out her update from last night!

http://www.youtube.com/watch?v=3Du1NsSTgGI

Week 13 - Sis

Hills and valleys with seasons changes can at times make us start feeling melancholy. Definition of melancholy.....sadness and mental depression. Some of us remember the old joke about melancholy, "My girl is melancholy; she has the body of a melon and the face of a collie." Cringe, I know! Attention please, the word does not make me think of depression. It reminds me of my father and his beautiful baritone singing voice. On the other hand that could be a really LOUD and scary baritone voice if he was mad at you. Okay, okay, back to melancholy. The word reminds me of my dad when at family parties or Sunday drives he would sing the old song, "Melancholy Baby". Two others he sang and favorites of mine were, "Mexicali Rose" and "Harbor Lights". Since my mother also had a good singing voice it would double the pleasure hearing them sing together. You might say today, he was my Portuguese/Mexican/ Mutsun indian, AMERICAN IDOL!

 

Week 13 - Lisa

I was so excited to find hard salami in the grocery store this week.  I resisted testing it for two days.  Finally cut into it and by looks was down right giddy.  Only to taste it and realize, nope it's not even close to my beloved Gallo Dry Salami from home.  Wah!

Baseball season started!  It's tough being a fan when you are living half way across the country.  Luckily, with new technology we can see the games via cable and internet.  So we just move the furniture around and watched Saturday nights game against the Dodgers on the laptop.  Nothing gets between us and our boys, the Gigantes!

Um, is she saluting me?

That looks says about a million things, most of them not publishable!

Week 12 - Lisa

It was a stormy week for a lot of reasons but mainly the weather.  Yikes, what happen to the beautiful sunshine the week before?  March had no lamb this year.  In with the lion, out with the lion.  I was actually grateful for the rain cause the pollen was a killer this past week.  By the time Saturday rolled around my March Madness bracket had exploded so I was left to root on my mom and sister.  Oh Elizabeth, how we will miss you!  Growing up I wanted to be Natalie Wood.  Her death was such a shocker.  I loved Elizabeth Taylor but I knew even as a 10 year old girl she was more "broad" than I was ever capable of being.  ;>  Giant, Cat on a Hot Tin Roof and Who's Afraid of Virginia Woolf were my favorite movies of hers.  Woke Sunday morning to read about Geraldine Ferraro.  Growing up in the 60's and 70's I was right smack in the middle of the women's movement so when Geraldine ran for VP, I was so proud and excited.  She was truly a trailblazer.  A fiesty, smart lady.

Here's some pictures I took this week with an iPhone app I downloaded called Hipstamatic.  Kind of cool.

Week 12 - Sis

Going from a beautiful week of sunny weather to one that is the opposite is not working for me.. Most of us know life can be a carnival, rocky at times or even a puzzle and think my week has covered all three parts. March Madness can represent more than a basketball tournament, although this year's event truly was madness with some surprising upsets. My own upset came when Ohio State lost! The most exciting part of the week was Saturday night's storm which sounded like a direct hit over our apartment. The news of Elizabeth Taylor and Geraldine Ferraro's deaths was a loss of strong, stand out representatives in the arts, politics and human rights. Hoping the new week will lift us all up, brighten our days and give me a couple of payoffs from the pools I'm playing in.

 

Week 11 - Lisa

Sad week.  Our cousin, Carol, or as she is known in our family, Sis, passed away.  So not a lot to report as my attention was mainly focused on her, her family and our entire family.  Other than that we are consumed by March Madness.  I gleefully rode through all of Thursday in first place but my underdog picks late in the night sent me spiraling to the bottom of the pack.  By Sunday night I had a severe case of  "potty mouth." We experienced the Super Moon on Saturday.  As my mom wrote it was kind of disappointing.  I did try the different color modes on my camera for some interesting results.  The last picture below is my favorite.



Week 11- Sis

Our view of the Super Moon was a bit disappointing last night. Thought it would be much larger but have to say it was very bright. It appeared after a lovely day in the 80's and then dragged those clouds into an overcast Sunday. Back to sunshine and warmer temps this week.

March Madness is just that. Notes, stats all reviewed and written on multiple pieces of paper and then transferred to my brackets sheet. One thing, red circles on the paper are not good. Heading to the Sweet Sixteen with a 1st place position in one pool and 16th place in a very large pool. Nope, no extra points for being 16th going into the Sweet Sixteen but thank you anyway.

Just like this one orange tulip Sis, you stood out in your family. Memories will sustain us in our lives and from the sadness of losing you too soon.Rest in peace cousin you will be missed but you are in our hearts always.

Week 10 - Lisa

Mail!  Let's talk about it.  Everyday my mom makes the trek up to the mail station to see who sent us what.  Will we receive goodies or news from home?  Which magazines?  We get lots and lots of magazines.  Or what kind of weird advertising or offers have come our way each day?  Well this week started off with me receiving a few items from a location called looneystuff.com.  The below note and pack of Hubba Bubba bubble gum came with my purchase.  I haven't chewed Hubba Bubba since playing softball.  A flood of memories came back.  Good times!

Next day in the mail I received the annual "Oh Lisa please please please buy magazines to support the Girls Scouts, or my school, or my Little League, you are such a sucker and I appreciate it so much, I know you'll do it because you had to when you were young to help support your softball or basketball team, so please please please?"  Love one of your our guilt-trip applying cousins or godchildren, Anjelica or Jacob or Jerome or Christina or Alannah, or winner winner chicken dinner today was Veronica Rose.  The list of possible beggers could go on and on.  ;>  The other piece of mail was from American Express. I've been working a lot of hours and days and feeling SO antsy to go on a trip.  I need a four or five day getaway badly.  So what comes in the mail?  American Express Rewards Guide - Grrr!  Cruel and "usual" punishment. 



And the last interesting or mention-worthy was my Genographic Project results from National Georgraphic.  My mom and I were so excited.  Going to see where that swab of spit led too!  Where are we from officially? 

AAATTTCAATTGAATTATTTGCCCAAATTCAACCCTTTAC - there ya go.  

A string of 569 A, C, T, and G letters makes up my very vague Mitochrondrial HVR 1 Sequence.  Something about nucleotides, the chemical building blocks of life, followed by the words - a mutation splitting; usually harmless.  USUALLY HARMLESS?  What the ????  I read that and snorted.  Now things about my family are seriously starting to make sense!  But the bottom line is the report we so anxiously awaited said <drum roll>  your people came from Africa stupid, just like everybody else.  Ms. Mitochondrial Eve as they named her started it all.  <sigh>  Well, hello I learned all this in Sunday School when I was four.  Oops, I forgot this is "science," so now it's really real.   Oh wait, that was a different Eve, this Eve goes back about 170,000 years.  Uh huh, sure.  Just my opinion people, calm down. 

So that Friday, on a return trip from getting lunch I have to wait and wait and wait for train to go by so I could get back to work.  Hmmm? Maybe I should open the door, jump out of the truck and onto the open door car of this train to wherever I ponder.  No mail, no offers, no requests, no hubba bubba. Maybe I'll be the next Ms. Mitrochrondrial Eve in our family to split off causing some future family member to ponder what the heck happen in the US around the 2011 time period.   Then reality and my common sense genes took over... With no money, no food, no internet. Um, yeah right!  Go back to work Lisa.

Week 10 - Sis

Food. We talk alot about it here on the blog and eat a lot of here in the apartment. If you know us or saw us, it shows. So Monday starts with me wanting to cook a hardboiled egg for potato salad. Reached for this little guy and put it in the microwave and 10 minutes later I have a Jackson Pollack imitation. You should have heard the pop one egg blowing up in that little microwave can make. Starting with a regular egg but didn't know a devil egg was my downfall!

Cat food I dropped while filling sunii's bowl. I tried to explain to her it was a fun way to eat it. Her look was telling me,"talk to the paw." Yeah. well a DOG would have been all over this prissy girl.

Thought these sliced leeks looked so colorful when I was preparing a soup tonight. Oh yeah, dropped half the fried bacon bits that were a needed ingredient and one that I love, on the floor. Finished the week almost as bad as I started it. Think we should eat out all next week. Sigh.