Mail! Let's talk about it. Everyday my mom makes the trek up to the mail station to see who sent us what. Will we receive goodies or news from home? Which magazines? We get lots and lots of magazines. Or what kind of weird advertising or offers have come our way each day? Well this week started off with me receiving a few items from a location called looneystuff.com. The below note and pack of Hubba Bubba bubble gum came with my purchase. I haven't chewed Hubba Bubba since playing softball. A flood of memories came back. Good times!
Next day in the mail I received the annual "Oh Lisa please please please buy magazines to support the Girls Scouts, or my school, or my Little League, you are such a sucker and I appreciate it so much, I know you'll do it because you had to when you were young to help support your softball or basketball team, so please please please?" Love one of your our guilt-trip applying cousins or godchildren, Anjelica or Jacob or Jerome or Christina or Alannah, or winner winner chicken dinner today was Veronica Rose. The list of possible beggers could go on and on. ;> The other piece of mail was from American Express. I've been working a lot of hours and days and feeling SO antsy to go on a trip. I need a four or five day getaway badly. So what comes in the mail? American Express Rewards Guide - Grrr! Cruel and "usual" punishment.
And the last interesting or mention-worthy was my Genographic Project results from National Georgraphic. My mom and I were so excited. Going to see where that swab of spit led too! Where are we from officially?
AAATTTCAATTGAATTATTTGCCCAAATTCAACCCTTTAC - there ya go.
A string of 569 A, C, T, and G letters makes up my very vague Mitochrondrial HVR 1 Sequence. Something about nucleotides, the chemical building blocks of life, followed by the words - a mutation splitting; usually harmless. USUALLY HARMLESS? What the ???? I read that and snorted. Now things about my family are seriously starting to make sense! But the bottom line is the report we so anxiously awaited said <drum roll> your people came from Africa stupid, just like everybody else. Ms. Mitochondrial Eve as they named her started it all. <sigh> Well, hello I learned all this in Sunday School when I was four. Oops, I forgot this is "science," so now it's really real. Oh wait, that was a different Eve, this Eve goes back about 170,000 years. Uh huh, sure. Just my opinion people, calm down.
So that Friday, on a return trip from getting lunch I have to wait and wait and wait for train to go by so I could get back to work. Hmmm? Maybe I should open the door, jump out of the truck and onto the open door car of this train to wherever I ponder. No mail, no offers, no requests, no hubba bubba. Maybe I'll be the next Ms. Mitrochrondrial Eve in our family to split off causing some future family member to ponder what the heck happen in the US around the 2011 time period. Then reality and my common sense genes took over... With no money, no food, no internet. Um, yeah right! Go back to work Lisa.


